How do I use Inspector Foode's Meat Identification Database?

If you have a cytochrome b gene sequence from a meat sample, you can obtain an identification of the species:

• copy the DNA sequence from your Assignment page
• click on the Simple search link in DNA Surveillance
• paste your sequence into the Data Entry window
• select the reference dataset and the genetic region
• click on the Submit button

Your sequence will be analysed automatically. Please wait about 15 seconds and then click the Retrieve Results button to view your results. It will take longer for results to become available if a bootstrap analysis was requested.

To perform a bootstrap analysis:

• click on the Advanced search link
• paste your sequence into the Data Entry window
• select the reference dataset and genetic region
• select the number of bootstrap replicates you require
• optionally enter an email address to which the results will be sent
• click on the Submit button

Reference Datasets

The reference sequences are described at the following link:

Domain	Cytochrome B = CytB
Meats	Link

So What Species Is It?

You need to consider two things when making a species identification:

1. the placement of the unknown sequence on the reference tree
2. the genetic distance between the unknown sequence and the nearest reference sequence.

If the unknown is placed in a group (clade) with just one species then there is a strong chance that it is a member of that species.

If the unknown has a much shorter genetic distance to one species than toother species then there is a strong chance that it is a member of the closest species.

If you have done a bootstrap analysis and the unknown sequence is in a clade with just one species AND the bootstrap proportion is much greater than 70, there is very strongevidence that the unknown is a member of that species.

The Results

The results will be displayed first as a phylogenetic tree in which the differences between sequences are proportional to the lengths of the horizontal branches separating the tips. The names of the reference species are colour-coded to help you identify close relatives. To save a copy of the tree as a PNG-format file, right-click (PC) or control-click (Mac) on the image and choose Download Image to Disk, or similar, from the pop-up menu.

If you have performed a bootstrap analysis, the resulting phylogenetic tree will display numbers at some of the nodes. These numbers are the percentage of bootstrap pseudoreplicates that contain the clade formed by the subtree starting at that node. This measure of bootstrap support is displayed only when at least 50% of the pseudoreplicates contain the clade. The phylogenetic tree displayed is the estimated tree, and not the consensus of the bootstrap pseudoreplicate trees.

You are able also to save the tree in NEWICK format, a format which can be opened and displayed by specialist software such as TreeView , FigTree , Geneious.

You can also copy the table of genetic distances and paste them into a file opened with NotePad (Windows) or SimpleText (Mac).

Potential Problems

Your sequence must be either in FASTA format or as a text nucleotide sequence. Use either UPPER or lowercase. For example:

>mysample
ACCATAATAGTACAGCTGAAGGAATCTGTAGAAATTAAACCATAATAGTACAGCTGAAGGAATC
GTAGAAATTAAACCATAATAGTACAGCTGAAGGAATCTGTAGAAATTAAACCATAATAGTACAG
CTGAAGGAATCTGTAGAAATTAA

or

ACCATAATAGTACAGCTGAAGGAATCTGTAGAAATTAAACCATAATAGTACAGCTGAAGGAATC
GTAGAAATTAAACCATAATAGTACAGCTGAAGGAATCTGTAGAAATTAAACCATAATAGTACAG
CTGAAGGAATCTGTAGAAATTAA

Only one sequence may be submitted at a time.

If your sequence contains illegal characters, that is those not included in the IUPAC ambiguity codes, then it will be rejected with an error message. If your sequence does contain any of the ambiguity codes, then they will be used both in aligning the sequence and in calculating evolutionary distances.

IUPAC Nucleotide Codes

Ambiguous	Symbol	Meaning	Origin of designation
	G	G	Guanine
	A	A	Adenine
	T	T	Thymine
	C	C	Cytosine
	U	U	Uracil
X	R	G or A	puRine
X	Y	T or C	pYrimidine
X	M	A or C	aMino
X	K	G or T	Keto
X	S	G or C	Strong interaction (3 H bonds)
X	W	A or T	Weak interaction (2 H bonds)
X	H	A or C or T	not-G, H follows G in the alphabet
X	B	G or T or C	not-A, B follows A
X	V	G or C or A	not-T (not-U), V follows U
X	D	G or A or T	not-C, D follows C
X	N	G or A or T or C	aNy

Bootstrapping

A bootstrap analysis will take longer than a simple search. The length of time will depend on the number of pseudoreplicates you have chosen and on the load on our server. Your screen will be refreshed about every 10 seconds, or you can choose to have the results sent to you by email.

Missing Species

The scientists who maintain this site may not have included all of the relevant species in the reference database. Beware!